rs2802288 chr6:108575012 A>G
- Sequence
gactgtgtggctggaggcagctgc[A/G]gtagaagttggcagtgccactgtg
- ASB in cell types
- TF-1 (erythroleukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TF-1 (erythroleukemia) | -0.44 | 1.77 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, birth weight, body mass index (bmi), cystatin c in serum, diastolic blood pressure (dbp), fluid intelligence (combination of multiple tests), hdl cholesterol, height, infant head circumference, intracranial volume, longevity, obesity with early age of onset (age >2), serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas