rs2802314 chr1:26104846 T>C
- Sequence
ggacagcccatttgcctcttccca[T/C]gtgacctctcttcagataggaaaa
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- MITF_HUMAN MEIS2_HUMAN MNT_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | n/a | 3.73 | 1.00 | 4.23 | Concordant | |||
| MEIS2_HUMAN | -0.83 | 0.83 | 1.00 | n/a | No Hit | |||
| MNT_HUMAN | -1.03 | 1.54 | 1.00 | 2.81 | Concordant | |||
| ANDR_HUMAN | 2.06 | -1.19 | 2.00 | n/a | No Hit | |||
| PKNX1_HUMAN | -0.78 | 0.78 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP birth weight, height, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid