rs2804778 chr1:234778381 C>A
- Sequence
ctgttcccccaaacactgtcccca[C/A]gtctattatgcaagcgcctattac
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) HEK293 (embryonic kidney) MV-4-11 (Childhood acute monocytic leukemia) HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- BRD4_HUMAN ZFX_HUMAN HLF_HUMAN INT13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.00 | 1.57 | 1.41 | n/a | n/a | |||
| ZFX_HUMAN | 0.23 | 2.08 | 1.86 | n/a | No Hit | |||
| HLF_HUMAN | n/a | 2.71 | 1.50 | n/a | No Hit | |||
| INT13_HUMAN | -1.46 | 2.22 | 1.00 | n/a | n/a | |||
| CDK8_HUMAN | 0.19 | 1.38 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 15
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, height, mitral annular calcium