rs2804885 chr10:33393964 T>G
- Sequence
ggggcagcagagagacctgggaaa[T/G]gtcaatgccctggcacgggcgtct
- ASB in cell types
- MDA-MB-231ERb(triple negative breast cancer)
- ASB for transcription factors
- ESR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR2_HUMAN | 0.41 | 2.40 | 2.00 | 3.25 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
