rs2805773 chr9:97741536 A>C
- Sequence
acgcccggtgacgggggcacctgc[A/C]aggcttcagggcgaatccctgact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MEF2B_HUMAN GCR_HUMAN IKZF1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.98 | n/a | 1.00 | n/a | No Hit | |||
| GCR_HUMAN | 0.45 | 1.13 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | 2.38 | n/a | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | -0.17 | 1.79 | 1.38 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, hdl cholesterol change with statins, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol
GTEx eQTL Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Testis, Thyroid