rs2805782 chr9:97737688 C>T
- Sequence
tggctcagcttgggtcatatgcct[C/T]tccctgggctaagggacttgttcc
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.68 | -1.00 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, hdl cholesterol change with statins, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid