rs2806271 chr1:53122046 C>T
- Sequence
ctggggggcaggtgctgtgtggtc[C/T]ggagcggagcagacctgggaatgc
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma) SU-DHL-2 (anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TMD8 (diffuse large B-cell lymphoma) | -4.99 | 2.91 | 2.00 | |||
| SU-DHL-2 (anaplastic large cell lymphoma) | 2.25 | -1.76 | 1.50 |
Items per page:
1 – 2 of 2