rs2810047 chr14:97410868 G>A
- Sequence
gggagtaacacactgctcaaagac[G/A]ctctttataaagggactttctgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RELB_HUMAN IKZF1_HUMAN ZN217_HUMAN SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RELB_HUMAN | -3.35 | 3.39 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | -2.06 | 2.11 | 2.00 | n/a | n/a | |||
| ZN217_HUMAN | -2.76 | 2.85 | 1.00 | n/a | n/a | |||
| SMCA5_HUMAN | n/a | 2.49 | 1.00 | n/a | n/a | |||
| MEF2B_HUMAN | -1.81 | 2.20 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), childhood acute lymphoblastic leukemia, college completion, diastolic blood pressure (dbp), hdl cholesterol change with statins, hip bone mineral density (bmd), late onset alzheimers disease, obesity with early age of onset (age >2), systolic blood pressure (sbp), triglycerides, variant creutzfeldt-jakob disease