rs2811198 chr1:97603245 A>G
- Sequence
tttaggactgtgtaagtacactat[A/G]tcccaaagtaaagaaatcattaat
- ASB in cell types
- 22RV1 (prostate carcinoma) LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.47 | 2.94 | 1.70 | 5.52 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, rheumatoid arthritis