rs2811778 chr9:136784639 C>A
- Sequence
agtggccgtccctaaaaaggataa[C/A]ctattccctttttttccttgattt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -3.95 | 3.63 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.32 | 0.76 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Vagina, Whole_Blood