rs2812035 chr14:38256080 G>A
- Sequence
cttggatctgtcccgctcgaggac[G/A]cagagctgtgtctggagcgcggtc
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -0.35 | 2.35 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1