rs2814086 chr1:227481692 G>C
- Sequence
tcttatggccccaaagacctgaac[G/C]tgtcatgctgttctgcacagcagc
- ASB in cell types
- kidney epithelial cell of proximal tubule
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| kidney | -4.89 | 2.82 | 2.00 | |||
| epithelial cell of proximal tubule | -2.33 | 2.67 | 1.00 |
Items per page:
1 – 2 of 2