rs281436 chr19:10286455 G>A
- Sequence
gttcactgcagtcttgaccttttg[G/A]gctcaagtgatcctcccacctcag
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.03 | 0.63 | 1.98 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.02 | 0.48 | 1.09 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Nucleus_accumbens_basal_ganglia, Heart_Left_Ventricle, Nerve_Tibial, Testis, Thyroid, Whole_Blood