rs2814734 chr9:85377874 A>C
- Sequence
ttaatgtggcaggatatggggtca[A/C]tcaaagtgagtaatgagatgtatt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -2.80 | 3.19 | 1.00 | -0.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, age at death with kuru exposure, asthma, height, partial epilepsy, premature ovarian failure, simpson-angus scale, tetrology of fallot, variant creutzfeldt-jakob disease