rs2816030 chr1:18531104 T>C
- Sequence
gtctctttcctgtgctttggggct[T/C]agcgaatgtcgccaccatccggtg
- ASB in cell types
- GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.55 | 1.65 | 1.79 | n/a | No Hit | |||
| STAG1_HUMAN | 3.14 | -0.63 | 1.56 | n/a | n/a | |||
| RAD21_HUMAN | 1.51 | -0.18 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, paternal transmission distortion, salmonella-induced pyroptosis, serum creatinine, spine bone mineral density (bmd)