rs2816432 chr8:5971014 G>A
- Sequence
ggaagcaccgctaggaggcctcag[G/A]aaacttatcatcaccgcagaggga
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -3.67 | 3.64 | 1.00 | |||
| IPSC-derived bipolar neuron | -2.34 | 2.35 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.90 | 2.07 | 1.00 |
Items per page:
1 – 3 of 3