rs2816705 chr14:48751926 T>C
- Sequence
tttcttcccaataaattatgactg[T/C]tttgagtttagggattctgtctta
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.04 | -1.84 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, cystatin c in serum, hdl cholesterol, neuroticism, total cholesterol, urinary albumin-to-creatinine ratio