rs2819084 chr6:156394351 T>C
- Sequence
atcagaaagttctgtgaaaggttt[T/C]gtaaactaagaagttttcagtacc
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | -1.74 | 2.53 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, homa-ir, rheumatoid arthritis, total cholesterol change with statins, triglycerides change with statins