rs2819590 chr3:4467058 C>T
- Sequence
gagtatcggtgagcggctgccgaa[C/T]tgccatgggcgccaggccgctggg
- ASB in cell types
- HEK293 (embryonic kidney) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 0.68 | 2.13 | 1.14 | n/a | n/a |
Items per page:
1 – 1 of 1