rs2820065 chr1:111334319 A>G
- Sequence
acagtttaggaagggcagggctcc[A/G]atcatttaccagagctgaggcaaa
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GBM39 (Human brain tumor) GM19240 (B cells Lymphoblastoid Cell Lines) pancreas
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.97 | 0.54 | 1.36 | n/a | n/a |
Items per page:
1 – 1 of 1