rs2820306 chr1:201954677 A>G
- Sequence
gtttgccctaaaggagctacgtgt[A/G]tttggtaacagcttcacagtaagt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.48 | 1.33 | 2.98 | |||
| HEK293 (embryonic kidney) | 0.72 | 0.10 | 1.98 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP high myopia, hip bone mineral density (bmd), longstanding arthritis, lung cancer (adenocarcinoma) in never smokers, lung cancer (non-small cell lung cancer) in never smokers, lung cancer in never smokers, mitral annular calcium, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood