rs2822719 chr21:14520813 G>C
- Sequence
ggcctcttttgttgttatgtggta[G/C]cctgggattcaatctgtaaggtag
- ASB in cell types
- monocytes from periferal blood MOLM14 (Adult acute myeloid leukemia) CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | 1.37 | 0.67 | 1.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | 1.00 | 0.27 | 1.00 | |||
| CD34+ hematopoietic stem cells | n/a | 2.55 | 2.00 |
Items per page:
1 – 3 of 3