rs2822785 chr21:14582207 G>A
- Sequence
tgtggcgaatacaagaggagcagt[G/A]gtcccagggtccaacttgtgctat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2C1_HUMAN P66B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | -1.26 | 2.13 | 2.00 | n/a | No Hit | |||
| P66B_HUMAN | -4.88 | 2.79 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP eye color, hdl cholesterol change with statins, hypertension (early onset hypertension), salmonella-induced pyroptosis, triglycerides change with statins, urinary albumin-to-creatinine ratio, waist hip ratio