rs2824078 chr21:16840227 T>C
- Sequence
actggctcttagtttctttcgatg[T/C]gattgagttatcaaatcagatgac
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 2.71 | -2.42 | 1.00 | -4.76 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, partial epilepsy, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio