rs283084 chr6:118282836 G>A
- Sequence
agaccacttcccttctccactgcc[G/A]tttcgagcaaaaccaagcaagcta
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.60 | 0.09 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, homa-ir, infant head circumference, parkinsons disease, systolic blood pressure (sbp)
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood