rs283122 chr5:32093457 T>C
- Sequence
tagtcccgccgttgccctgaaata[T/C]ggtggacccctgaacaacatgagg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.59 | 0.49 | 1.47 | n/a | No Hit | |||
| ANDR_HUMAN | 2.08 | -0.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, triglycerides