rs283381 chr3:115693000 C>T
- Sequence
cctattgcactgctatgcagtttg[C/T]ctggggtcatttcttcctggagag
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- PKNX1_HUMAN STAG1_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 3.12 | -2.79 | 1.00 | n/a | No Hit | |||
| STAG1_HUMAN | -0.05 | 0.66 | 1.00 | n/a | n/a | |||
| STAG2_HUMAN | 2.42 | -2.26 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), aortic valve calcium, asthma, primary rhegmatogenous retinal detachment, rheumatoid arthritis