rs283727 chr8:127301115 G>A
- Sequence
gagcacccaccgtatgctaattgc[G/A]ttacctacatcctcatataaatta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.53 | 0.63 | 1.06 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.73 | 1.16 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), refractive error