rs28576697 chr1:935265 T>C
- Sequence
agctgcacgtgtctgccggtgccg[T/C]gtgtgcgtggggcgcgtctcatca
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZEB2_HUMAN HIC1_HUMAN SCRT2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZEB2_HUMAN | -2.32 | 3.11 | 2.00 | n/a | No Hit | |||
| HIC1_HUMAN | -5.01 | 2.92 | 2.00 | n/a | No Hit | |||
| SCRT2_HUMAN | n/a | 1.58 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg