rs286232 chr19:11797582 A>G
- Sequence
ttgtctcaggtaaccgatcaatga[A/G]gtgaataacctgtagggggcagca
- ASB in cell types
- erythroid cells gastroesophageal sphincter MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.93 | n/a | 2.00 | |||
| gastroesophageal sphincter | -0.10 | 1.25 | 1.00 | |||
| MDM(monocyte derived macrophages) | 1.81 | n/a | 2.00 |
Items per page:
1 – 3 of 3