rs286593 chr5:154995905 G>A
- Sequence
cctagacaatgagatagctgtcct[G/A]cttctgcccccatgtggtctgaca
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.52 | 1.32 | 1.59 | 0.20 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, partial epilepsy, prop taste detection threshold, resistance to kuru in aged women despite likely exposure
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid