rs28669173 chr1:1681101 C>T
- Sequence
acccctgcagaggcacccacggtt[C/T]gttcctgtcactgactgttcccag
- ASB in cell types
- HepG2 (hepatoblastoma) SUP-B15 (Childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- GCR_HUMAN SKI_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -1.81 | 2.14 | 1.00 | 2.41 | Concordant | |||
| SKI_HUMAN | -1.44 | 1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Colon_Transverse, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood