rs28890196 chr21:10712196 G>C
- Sequence
caccgcattccattccactccatt[G/C]cactccactccactccccttcacc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZN671_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN671_HUMAN | n/a | 2.69 | 2.00 | 6.57 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
