rs290427 chr20:54057290 G>A
- Sequence
aggctgtgcacatttggggaaaag[G/A]aatatatgaaatatcgctggagac
- ASB in cell types
- HepG2 (hepatoblastoma) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -4.99 | 2.69 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1