rs292377 chr18:5103505 C>T
- Sequence
ccagcctggagatggcaccagagg[C/T]atctgtataacaaaccttactaac
- ASB in cell types
- MS-1 (Small cell lung carcinoma) NB69 (neuroblastoma) GM02610 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 2.16 | -1.48 | 1.50 | |||
| NB69 (neuroblastoma) | 2.56 | -2.35 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -2.79 | 1.49 | 6.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.03 | 1.27 | 5.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), parkinsons disease