rs294282 chr3:31094477 G>A
- Sequence
taaaaaattagttttctaggctat[G/A]tccactatttcctgagggcaggtt
- ASB in cell types
- LN95(Prostate adenocarcinoma)
- ASB for transcription factors
- HXB13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXB13_HUMAN | 2.37 | -0.97 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, diastolic blood pressure (dbp), obsessive-compulsive disorder (ocd), rheumatoid arthritis, systolic blood pressure (sbp), triglycerides