rs296709 chr9:90976267 C>G
- Sequence
ctcagggggaggcacacaggaact[C/G]tgcctgcggtgggccaggccggga
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -1.90 | 2.13 | 1.00 | 2.10 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
