rs296762 chr12:49967317 G>A
- Sequence
cctatcccaatgcatccccgcccc[G/A]ctatccgggtggggcgcagaagag
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) neutrophils from periferal blood foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.52 | -0.12 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1