rs296889 chr9:83980656 G>A
- Sequence
gctggggggaggggcggctagggg[G/A]cgaacctctcgcgagatctaacaa
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) upper lobe of left lung
- ASB for transcription factors
- TF65_HUMAN STAT1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.03 | -5.54 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.75 | 0.11 | 2.33 | n/a | No Hit | |||
| STAG1_HUMAN | 0.20 | 1.34 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood