rs298217 chr8:64382105 G>C
- Sequence
tgcggcgtgccgtgagagtccttt[G/C]acaatctcagctttcatctaggtc
- ASB in cell types
- foreskin keratinocyte GM02630 (Fanconi anemi) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.24 | 1.89 | 2.83 | |||
| GM02630 (Fanconi anemi) | 0.78 | -0.14 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.61 | 0.60 | 1.00 |
Items per page:
1 – 3 of 3