rs299247 chr18:22709809 C>T
- Sequence
aagaatgaccttgttagactcatt[C/T]tgcagagcaccgtggatgtcagtg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.02 | 0.43 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), ldl cholesterol, schizophrenia, urinary albumin-to-creatinine ratio