rs299721 chr18:48639762 A>C
- Sequence
gtagcccaacagtgtgggggccgg[A/C]tccttgcttctcactgctctaccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.46 | 0.58 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.64 | 1.21 | 1.00 |
Items per page:
1 – 2 of 2