rs299743 chr18:48669086 C>T
- Sequence
ctggccataggacttttatgacac[C/T]gatctcgtgctgcccccagtggtg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.16 | 1.75 | 1.48 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol, microalbuminuria, systolic blood pressure (sbp), total cholesterol