rs300543 chr9:30774541 C>T
- Sequence
aggcgcaggagtaagaggccctgc[C/T]gaacatcgaggtcaatttgggggc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) 2588 (Lymphoblastoid Cell Lines) WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.65 | 2.29 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.24 | 1.45 | 1.33 | |||
| WA01 (H1, human embryonic stem cells) | 1.19 | -0.47 | 1.17 |
Items per page:
1 – 3 of 3