rs301923 chr3:97692773 A>G
- Sequence
gtggctcagttttcagtgacctca[A/G]ttttctgctctgttgtttttcaaa
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 1.36 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, hdl cholesterol, hip bone mineral density (bmd), multiple sclerosis, age of onset