rs302630 chr6:39791392 T>C
- Sequence
agccatttccctaagcccctttgg[T/C]gaggtggagaaacagacaaccact
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.17 | 1.46 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.95 | -1.68 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.85 | -0.43 | 1.00 |
Items per page:
1 – 3 of 3