rs304115 chr15:100713352 G>A
- Sequence
gttcagctgtggagcccgggcagg[G/A]agcctcgcctggtctgtttatccg
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.47 | 0.55 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, college completion, paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, paternal transmission distortion, variant creutzfeldt-jakob disease, years of education