rs305061 chr16:85942053 C>T
- Sequence
ccatgctgtccgtgtgacttacca[C/T]ggtggacgttgaccttggccacct
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 1.73 | -3.02 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic lymphocytic leukemia, chronic lymphocytic leukemia (igvh mutation status), chronic lymphocytic leukemia (overall survival), college completion, late onset alzheimers disease, ldl cholesterol, partial epilepsy, urinary albumin-to-creatinine ratio
PheWAS acute bronchitis and bronchiolitis, acute tonsillitis, blood in stool, cardiac arrest, cardiac arrest & ventricular fibrillation, cardiomegaly, carditis, cerebral aneurysm, chorioretinal scars, congenital cataract and lens anomalies, cystic kidney disease, dermatomycoses, diseases of nail, disorders of lacrimal system, disorders of other cranial nerves, dry eyes, dyspareunia, dysthymic disorder, gangrene, genitourinary congenital anomalies, hemorrhage of gastrointestinal tract, herpes zoster with nervous system complications, hypothyroidism, joint effusions, keloid scar, keratitis, keratoconjunctivitis, noninfectious, male infertility and abnormal spermatozoa, neoplasm of uncertain behavior, open wound of lip and mouth, other abnormal blood chemistry, other biliary tract disease, other cells and casts in urine, other rheumatic heart disease, other specified diseases of nail, peritonitis and retroperitoneal infections, phobia, poisoning by psychotropic agents, prolapse of vaginal vault after hysterectomy, respiratory failure, respiratory failure, insufficiency, arrest, salicylates causing adverse effects in therapeutic use, spasm of muscle, stomach cancer, urinary incontinence, ventricular fibrillation & flutter