rs305466 chr1:87712482 G>C
- Sequence
gagtcacagaaattctctgagata[G/C]tctgacacctaagtcacaggcagg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.33 | -0.81 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, homa-b