rs307748 chr8:141154347 C>T
- Sequence
catatctcaaatattccagggcta[C/T]gcggtctcttagcccaggcccctg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HAEC (human aortic endothelial cells) MDA-MB-231 (breast adenocarcinoma) breast tumor xenograft
- ASB for transcription factors
- TF65_HUMAN JUN_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 0.48 | 2.38 | 3.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.31 | 1.00 | 1.94 | n/a | No Hit | |||
| SUH_HUMAN | -1.74 | 2.67 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, asthma, bipolar disorder, height, ldl cholesterol, maternal transmission distortion, premature ovarian failure, transmission distortion